KEGG   Vibrio vulnificus MO6-24/O: VVMO6_03514Help
Entry
VVMO6_03514       CDS       T01415                                 

Definition
ribokinase (EC:2.7.1.15)
Orthology
K00852  
ribokinase [EC:2.7.1.15]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Pentose phosphate pathway
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Carbohydrate metabolism
   00030 Pentose phosphate pathway
    VVMO6_03514
Enzymes [BR:vvm01000]
 2. Transferases
  2.7  Transferring phosphorus-containing groups
   2.7.1  Phosphotransferases with an alcohol group as acceptor
    2.7.1.15  ribokinase
     VVMO6_03514
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
II:621622..622542
Genome map
AA seq 306 aa AA seqDB search
MNKLVVLGSVNADHVLQVPSFPRPGETLHGRNYQVIPGGKGANQAVAAARLGADTSFIAC
VGDDSFGINIRENFKLDGIQIDGVKMQPNCPTGIAMIQVADSGENSICISAEANAKLTEA
AIESDLPRIRDARFLLMQLETPICGIELAAREAKAAKTNVILNPAPARTLSDELLACIDV
ITPNETEAQVLTGIEVVDDESAQQAANVLHQKGIEIVMITLGSKGVWLSENGRGQRICGF
KVDVTDTTAAGDTFNGALVTGLLEDMPLESAIKFAHAAAAISVTRFGAQTSIPTRKEVDE
FLAAHS
NT seq 921 nt NT seq  +upstreamnt  +downstreamnt
atgaacaagttagtggttttaggtagtgttaacgcagaccatgtgcttcaagtcccatcc
ttcccacgtcctggggaaacgttacatgggcgaaattatcaagtgattccgggtgggaaa
ggggccaatcaagccgttgccgctgcacgtttaggcgcagatacgagcttcatcgcttgt
gttggggatgactcgtttggcatcaatattcgtgaaaacttcaagcttgacggtattcaa
atcgatggcgtgaagatgcagcccaattgcccaacaggcatcgcaatgattcaagtcgca
gacagcggcgagaacagtatttgtatctcggcggaagccaatgccaaattaaccgaggcg
gccattgaatcggatttgccacgtatccgtgatgccagatttcttcttatgcagttagaa
acccctatctgcgggatagagcttgcggccagagaagctaaagcggcaaaaactaatgtg
attttaaatccagcaccagcgcgcacattatccgacgagctactagcatgcatcgacgtg
atcacaccaaatgagacagaagctcaggtgttaaccgggattgaggtagtggatgatgaa
agcgctcagcaagccgccaatgtcttacatcaaaaaggcattgagatcgtcatgattacg
cttggctctaaaggggtttggctcagcgaaaatggcagggggcaacgcatctgcggtttt
aaagtcgacgtcaccgatacaaccgccgcgggagatacttttaatggggcattggtcact
ggtttattggaggatatgcctttagaatcagcgattaagtttgctcatgcagcggcggcg
atttcagtgactcgatttggagcgcaaacttctattccaacccgtaaagaggtcgatgag
tttttagccgcgcacagttag

DBGET integrated database retrieval system