KEGG   Vibrio vulnificus MO6-24/O: VVMO6_03518Help
Entry
VVMO6_03518       CDS       T01415                                 

Definition
fatty acid desaturase ; Delta-9 fatty acid desaturase (EC:1.14.19.1)
Orthology
K00507  
stearoyl-CoA desaturase (delta-9 desaturase) [EC:1.14.19.1]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Biosynthesis of unsaturated fatty acids
Fatty acid metabolism
Class
Metabolism; Overview; Fatty acid metabolism [PATH:vvm01212]
Metabolism; Lipid metabolism; Biosynthesis of unsaturated fatty acids [PATH:vvm01040]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
II:complement(625531..626655)
Genome map
AA seq 374 aa AA seqDB search
MQQQKPPFIWLNIVIFVTSLVLALVVTPWYGIKEGFGFEHLIWLLVTFSFTNLSITAGYH
RLWSHKTYEAHPLLRVVFAIGGAFSLQNSALHWSSDHRMHHKFVDHHDKDPYSASRGFWF
SHIGWMLRDYNQSTYNDYTNCRDLQKDPVIMWQHKYYVPLAIATNLGIPLLLGWYYQDII
GMLLVVGALRLTLSHHSTFFINSLAHIWGKQTFTDKNSARDNGFLAILTFGEGYHNFHHI
FENDYRNGIYWWQYDPTKWLIKSCSWLGLTRNLRLTPQMKIDKARAATRLKNALHQLAQR
GEQESLKQQLQLEFDGLVATMKDYYDAKKQLLECKKQTALKKYEVALVKIRYQQAKEDLL
SRYKRWHALTAHYA
NT seq 1125 nt NT seq  +upstreamnt  +downstreamnt
ttgcaacaacagaaaccgccattcatatggctcaacattgtcatctttgttacgtcatta
gtgctcgcccttgtggtcacaccttggtacggtatcaaggaagggtttggttttgagcac
ctcatctggttactcgtcacttttagcttcaccaacctttccattactgctggctaccat
cgtttgtggagccataagacttacgaagcgcatcctttgctccgtgttgtctttgccatc
ggcggtgctttctctctacaaaacagcgccttgcattggtcttcagatcatcgtatgcac
cacaagtttgttgatcaccacgataaagatccctactccgcgagccgcggcttctggttt
tctcatattggctggatgctacgagactacaatcaatcaacctacaacgattacactaac
tgtcgcgacctccaaaaagatcccgtcattatgtggcagcacaaatactatgtgccacta
gcaatagcgacaaacctgggcatccctttgctacttggttggtattatcaggacatcatc
ggcatgctacttgtggttggtgcactacgtttaacactgagtcatcattcaacgttcttt
attaattccttagctcatatttgggggaagcagacctttaccgacaaaaacagtgcaaga
gacaatgggttcttagccattttaacctttggtgagggataccataattttcaccatatc
tttgaaaacgactatcgcaacgggatttattggtggcagtacgacccaacaaaatggctg
atcaaaagctgttcatggttaggtctaacccgcaacttgcgcctcactccacaaatgaaa
atcgacaaagccagagctgccacacggctgaaaaatgcgctccaccagcttgcgcagcgt
ggtgagcaagagtcactcaaacaacaattgcaattggaattcgatggcctagttgccacg
atgaaagattactacgatgcaaagaaacagcttctagagtgtaaaaaacagactgctttg
aagaaatatgaggtagcgttagtaaaaatacgttatcaacaagccaaagaagacctgtta
agccgttataaacgctggcacgcgctcacagcgcattatgcttag

DBGET integrated database retrieval system