KEGG   Vibrio vulnificus MO6-24/O: VVMO6_03759Help
Entry
VVMO6_03759       CDS       T01415                                 

Definition
arylesterase (EC:3.1.1.2)
Orthology
K10804  
acyl-CoA thioesterase I [EC:3.1.2.- 3.1.1.5]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Biosynthesis of unsaturated fatty acids
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Lipid metabolism
   01040 Biosynthesis of unsaturated fatty acids
    VVMO6_03759
Enzymes [BR:vvm01000]
 3. Hydrolases
  3.1  Acting on ester bonds
   3.1.1  Carboxylic-ester hydrolases
    3.1.1.5  lysophospholipase
     VVMO6_03759
   3.1.2  Thioester hydrolases
    3.1.2.-  
     VVMO6_03759
Lipid biosynthesis proteins [BR:vvm01004]
 Fatty acid synthase
  Component type
   VVMO6_03759
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
II:complement(898594..899091)
Genome map
AA seq 165 aa AA seqDB search
MSAEQAWPNLLPEALNTYGKNVEVINASISGDTTGNGLSRLPELLKTHSPDWVLIELGAN
DGLRGFPHKVISSNLSRMIQLSKASDAKVALMQIRVPPNYGKRYTDAFVELYPTLAEHHQ
VPLFPFFLEEVIVKPEWMMPDGLHPMPEAQPWIAQFVAKTFYKHL
NT seq 498 nt NT seq  +upstreamnt  +downstreamnt
atgtctgcagagcaggcttggcctaatttgttaccagaagcattgaatacatacggaaaa
aacgtagaagtgatcaacgccagtatctctggagacacaaccggcaatggactatctcgt
ctgcctgagttgttaaaaacgcactcaccagactgggtgcttattgagctgggtgccaat
gatggcttgcgaggtttcccgcataaagtgatctcttcaaacctttcgcgaatgattcaa
ctcagtaaagcctcagacgctaaagtagcactgatgcaaattcgtgtgccaccgaactat
ggcaagcgctacaccgatgcatttgtcgaactctaccctacgcttgctgaacatcaccaa
gttccgttgttcccctttttcttagaagaagtgatcgtgaaaccggaatggatgatgcct
gatggattacacccaatgcccgaagctcagccttggatcgctcaatttgttgcaaaaacg
ttttacaaacatctctga

DBGET integrated database retrieval system