KEGG   Vibrio vulnificus MO6-24/O: VVMO6_04342Help
Entry
VVMO6_04342       CDS       T01415                                 

Definition
cytochrome c551 peroxidase (EC:1.11.1.5)
Orthology
K00428  
cytochrome c peroxidase [EC:1.11.1.5]
Organism
vvm  Vibrio vulnificus MO6-24/O
Brite
Enzymes [BR:vvm01000]
 1. Oxidoreductases
  1.11  Acting on a peroxide as acceptor
   1.11.1  Peroxidases
    1.11.1.5  cytochrome-c peroxidase
     VVMO6_04342
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
II:complement(1567740..1568726)
Genome map
AA seq 328 aa AA seqDB search
MKKIIAVSLLSVVSFATLAERQAQEPIKVIDPVVGLDAKKVELGKTLWFEPRLSASNTIS
CNSCHNVAKGGVDNLPSSIGHKWAIGPINSPTVFNSDLNFVQFWNGRAKDLQEQAAGPIE
NPLEMAFTHQLAIDTLKSIPQYRTWFKQAYGVEEFTLEQVTDAIATFEKTLRTPNAPFDL
WLRGEDSALTTAQVEGYELFKAKGCTACHSGPLAGGQMYQKMGLVKPFETANPDVGRKAI
TGKEFDEFVFKVPTLRNIELTYPYFHDGSVWDLQEAVEVMADIQLGQKLTKDESGKITEF
LKSLTGEQPQIVLPHLPPSTIETARPQI
NT seq 987 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaaaatcattgcagtgagtctcttatctgtcgtgtcatttgcgaccttggcagaa
cgtcaggcgcaagaaccgatcaaagtgattgatccggttgttgggttggatgcgaagaaa
gttgaattgggaaaaaccttatggtttgagcctcgactatcagcttctaacaccatttcg
tgtaactcatgccataacgtggccaagggtggggtggataacctgccaagctccattgga
cataaatgggcgattgggccgatcaattcacccacggtgtttaactcggatctcaacttc
gtgcagttctggaatggtcgcgccaaagatcttcaagagcaggccgcagggccgattgag
aatccgctagagatggcatttacccatcagttggcgatcgacaccttgaaatcgattcct
caataccgcacttggttcaaacaagcgtatggggtggaagagttcaccttagagcaagtt
acggacgccatcgcgacctttgagaaaacgcttcgtacccccaatgcaccgtttgacttg
tggttaagaggggaagacagcgcgctcaccacggcccaagtggaaggttatgagctgttc
aaagcgaaggggtgtacggcgtgtcatagcgggcccttagccggagggcagatgtaccaa
aaaatggggttagtaaagccttttgaaaccgccaatccagatgtagggcgcaaggcgatt
actggcaaagagttcgatgagtttgtctttaaggtgccgacattacgcaatattgagctc
acctacccctacttccacgacggctcagtgtgggatctgcaagaagcggtagaagtgatg
gcagacattcagttggggcaaaaactgaccaaagatgagtctggaaaaatcaccgagttt
ctcaaatctctgacgggtgaacagccgcaaatcgttttgccgcatttaccaccgtctacg
attgaaacggcgcgaccacaaatctaa

DBGET integrated database retrieval system