KEGG   Vibrio vulnificus CMCP6: VV2_1647Help
Entry
VV2_1647          CDS       T00108                                 

Definition
malate synthase
Orthology
K01638  
malate synthase [EC:2.3.3.9]
Organism
vvu  Vibrio vulnificus CMCP6
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Class
Metabolism; Overview; Carbon metabolism [PATH:vvu01200]
Metabolism; Carbohydrate metabolism; Pyruvate metabolism [PATH:vvu00620]
Metabolism; Carbohydrate metabolism; Glyoxylate and dicarboxylate metabolism [PATH:vvu00630]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
II:1800617..1801237
Genome map
AA seq 206 aa AA seqDB search
MCSKTKLLCVIQEDKTMNMLTFDKNENQQQRPFIAEAVFAVEAVNSNQQDEKQQKAKQLL
DRMFPLESGSHQDVTSYVIDYRHLMAYFADGSHSGLQAPKHFVAFTGEKEDPCSILLRDE
SGSHIEVMLGCHKGTGSVELVDIDDIQLETRTTFSPELTGDAPTAMRHWISLVKGDVNGK
PMASSEDKEYTAKSGEDYVLSYCYSI
NT seq 621 nt NT seq  +upstreamnt  +downstreamnt
atgtgctctaaaacaaaattgttgtgtgttatccaagaggacaagacgatgaatatgctg
acattcgataaaaatgaaaaccaacaacaacgcccatttatcgctgaagctgtatttgcc
gtcgaagcggtaaattctaatcagcaagatgaaaaacaacaaaaagcgaaacagcttctc
gacagaatgtttccgctagaatctggctcacatcaagacgtaaccagctatgtgatcgat
tatcgccacctgatggcatattttgcagatggttcccacagtggccttcaagcacccaaa
cattttgtcgctttcaccggtgagaaagaagatccttgctctatcttgctacgcgatgaa
tcaggcagtcacattgaagtgatgctgggttgccacaaaggtacaggaagtgtggaactt
gtcgatatcgatgatattcaattggaaacgcgcacgacctttagccctgaattaacgggt
gatgcaccaacggcaatgcgtcattggatcagtctagtgaaaggcgatgtgaatggtaag
ccaatggcaagcagtgaagataaagaatataccgcgaaaagtggtgaagattatgtactg
agttactgctatagcatctaa

DBGET integrated database retrieval system