KEGG   Vibrio vulnificus YJ016: VVA0459Help
Entry
VVA0459           CDS       T00150                                 

Definition
malate synthase (EC:2.3.3.9)
Orthology
K01638  
malate synthase [EC:2.3.3.9]
Organism
vvy  Vibrio vulnificus YJ016
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:vvy00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    VVA0459
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    VVA0459
   00630 Glyoxylate and dicarboxylate metabolism
    VVA0459
Enzymes [BR:vvy01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     VVA0459
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
II:525934..526554
Genome map
AA seq 206 aa AA seqDB search
MCSKTKLLCVIQEDKTMNMLTFDKNENQQQRPFIAEAVFAVEAVNSNQQDEKQQKAKQLL
DRMFPLESGSHQDVTSYVIDYRHLMAYFADGSHSGLQAPKHFVAFTGEKEDPCSILLRDE
SGSHIEVMLGCHKGTGSVELVDIDDIQLETRTTFSPELTGDAPTAMRHWISLVKGDVNGK
PMASSEDKEYTAKSGEDYVLSYCYSI
NT seq 621 nt NT seq  +upstreamnt  +downstreamnt
atgtgctctaaaacaaaattgttgtgtgttatccaagaggacaagacgatgaatatgctg
acattcgataaaaatgaaaaccaacaacaacgcccatttatcgctgaagctgtatttgcc
gtcgaagcggtaaattctaatcagcaagatgaaaaacaacaaaaagcgaaacagcttctc
gacagaatgtttccgctagaatctggctcacatcaagacgtaaccagctatgtgatcgat
tatcgccacctgatggcatattttgcagatggttcccacagtggccttcaagcacccaaa
cattttgtcgctttcaccggtgagaaagaagatccttgctctatcttgctacgcgatgaa
tcaggcagccacattgaagtgatgctgggttgccacaaaggcacaggaagtgtggaactt
gtcgatatcgatgatattcaattggaaacgcgcacgacctttagccctgaattaacgggt
gatgcaccaacggcaatgcgtcattggatcagtctagtgaaaggcgatgtgaatggtaag
ccaatggcaagcagtgaagataaagaatataccgcgaaaagtggtgaagattatgtactg
agttactgctatagcatctaa

DBGET integrated database retrieval system