KEGG   Vibrio vulnificus YJ016: VVA0459Help
Entry
VVA0459           CDS       T00150                                 

Definition
malate synthase (EC:2.3.3.9)
Orthology
K01638  
malate synthase [EC:2.3.3.9]
Organism
vvy  Vibrio vulnificus YJ016
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Class
Metabolism; Overview; Carbon metabolism [PATH:vvy01200]
Metabolism; Carbohydrate metabolism; Pyruvate metabolism [PATH:vvy00620]
Metabolism; Carbohydrate metabolism; Glyoxylate and dicarboxylate metabolism [PATH:vvy00630]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
II:525934..526554
Genome map
AA seq 206 aa AA seqDB search
MCSKTKLLCVIQEDKTMNMLTFDKNENQQQRPFIAEAVFAVEAVNSNQQDEKQQKAKQLL
DRMFPLESGSHQDVTSYVIDYRHLMAYFADGSHSGLQAPKHFVAFTGEKEDPCSILLRDE
SGSHIEVMLGCHKGTGSVELVDIDDIQLETRTTFSPELTGDAPTAMRHWISLVKGDVNGK
PMASSEDKEYTAKSGEDYVLSYCYSI
NT seq 621 nt NT seq  +upstreamnt  +downstreamnt
atgtgctctaaaacaaaattgttgtgtgttatccaagaggacaagacgatgaatatgctg
acattcgataaaaatgaaaaccaacaacaacgcccatttatcgctgaagctgtatttgcc
gtcgaagcggtaaattctaatcagcaagatgaaaaacaacaaaaagcgaaacagcttctc
gacagaatgtttccgctagaatctggctcacatcaagacgtaaccagctatgtgatcgat
tatcgccacctgatggcatattttgcagatggttcccacagtggccttcaagcacccaaa
cattttgtcgctttcaccggtgagaaagaagatccttgctctatcttgctacgcgatgaa
tcaggcagccacattgaagtgatgctgggttgccacaaaggcacaggaagtgtggaactt
gtcgatatcgatgatattcaattggaaacgcgcacgacctttagccctgaattaacgggt
gatgcaccaacggcaatgcgtcattggatcagtctagtgaaaggcgatgtgaatggtaag
ccaatggcaagcagtgaagataaagaatataccgcgaaaagtggtgaagattatgtactg
agttactgctatagcatctaa

DBGET integrated database retrieval system