KEGG   Vibrio vulnificus YJ016: VVA0459Help
Entry
VVA0459           CDS       T00150                                 

Definition
(GenBank) malate synthase
  KO
K01638  malate synthase [EC:2.3.3.9]
Organism
vvy  Vibrio vulnificus YJ016
Pathway
vvy00620  Pyruvate metabolism
vvy00630  Glyoxylate and dicarboxylate metabolism
vvy01100  Metabolic pathways
vvy01110  Biosynthesis of secondary metabolites
vvy01120  Microbial metabolism in diverse environments
vvy01200  Carbon metabolism
Module
vvy_M00012  Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:vvy00001]
 Metabolism
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    VVA0459
   00630 Glyoxylate and dicarboxylate metabolism
    VVA0459
Enzymes [BR:vvy01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     VVA0459
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: BAC96485
UniProt: Q7MF61
Position
II:525934..526554
Genome map
AA seq 206 aa AA seqDB search
MCSKTKLLCVIQEDKTMNMLTFDKNENQQQRPFIAEAVFAVEAVNSNQQDEKQQKAKQLL
DRMFPLESGSHQDVTSYVIDYRHLMAYFADGSHSGLQAPKHFVAFTGEKEDPCSILLRDE
SGSHIEVMLGCHKGTGSVELVDIDDIQLETRTTFSPELTGDAPTAMRHWISLVKGDVNGK
PMASSEDKEYTAKSGEDYVLSYCYSI
NT seq 621 nt NT seq  +upstreamnt  +downstreamnt
atgtgctctaaaacaaaattgttgtgtgttatccaagaggacaagacgatgaatatgctg
acattcgataaaaatgaaaaccaacaacaacgcccatttatcgctgaagctgtatttgcc
gtcgaagcggtaaattctaatcagcaagatgaaaaacaacaaaaagcgaaacagcttctc
gacagaatgtttccgctagaatctggctcacatcaagacgtaaccagctatgtgatcgat
tatcgccacctgatggcatattttgcagatggttcccacagtggccttcaagcacccaaa
cattttgtcgctttcaccggtgagaaagaagatccttgctctatcttgctacgcgatgaa
tcaggcagccacattgaagtgatgctgggttgccacaaaggcacaggaagtgtggaactt
gtcgatatcgatgatattcaattggaaacgcgcacgacctttagccctgaattaacgggt
gatgcaccaacggcaatgcgtcattggatcagtctagtgaaaggcgatgtgaatggtaag
ccaatggcaagcagtgaagataaagaatataccgcgaaaagtggtgaagattatgtactg
agttactgctatagcatctaa

DBGET integrated database retrieval system