KEGG   Xanthomonas oryzae pv. oryzae PXO99A: PXO_01699Help
Entry
PXO_01699         CDS       T00763                                 

Definition
beta-galactosidase
Orthology
K01190  
beta-galactosidase [EC:3.2.1.23]
Organism
xop  Xanthomonas oryzae pv. oryzae PXO99A
Pathway
Galactose metabolism
Other glycan degradation
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:xop00001]
 Metabolism
  Carbohydrate metabolism
   00052 Galactose metabolism
    PXO_01699
  Lipid metabolism
   00600 Sphingolipid metabolism
    PXO_01699
  Glycan biosynthesis and metabolism
   00511 Other glycan degradation
    PXO_01699
Enzymes [BR:xop01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.23  beta-galactosidase
     PXO_01699
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
3188091..3188792
Genome map
AA seq 233 aa AA seqDB search
MASQFGVLDRCGFPKDNYWYYRTQWTGEPVLHLFPHWNWDGLLQPDDNGRIDVWCHSNLK
AVELLVNGVSQGMQQVPAYGHVAWRVVYAPSAIEARGYRGGKLVLSERRETTGKPAAIHL
SCDRTTLRANAEDVAVAKVAIVDAQGRLVPTADNQVQFASRGPARLIGVGNGDPSSHEDD
KAPQRKAFNGLCAALLQTTRNSGDIVLQATAPRLTSAKLRLPAASVKARASVG
NT seq 702 nt NT seq  +upstreamnt  +downstreamnt
gtggcgtcgcaattcggcgtgctcgatcgctgcgggtttccgaaagacaactactggtac
taccgcacgcaatggaccggcgaacctgtgctgcatttgttcccgcactggaactgggac
ggcctgctgcagccggacgacaacggccggatcgacgtctggtgccacagcaatctcaaa
gcggtagaactgctggtcaacggcgtcagccaaggcatgcagcaagtgccggcttacggc
catgtcgcatggcgtgtggtctacgcacccagcgcaatcgaagcacgcggctatcgcggc
ggcaagctggtgctcagcgagcgccgcgaaaccacaggcaagccggccgcgatccacctc
agctgcgaccgcaccaccctgcgcgccaatgccgaagatgtcgcagtggcgaaggtggca
atcgtcgacgcacaaggccgtctggtaccaacggccgacaaccaggtgcagttcgcgtcg
cgcggccctgcccggctgatcggcgtcggcaacggcgaccccagcagccacgaagacgac
aaggcaccacagcgcaaggcattcaacggcctgtgtgcggcgctgttgcagaccacgcgc
aacagcggcgatatcgtgctgcaggcgaccgcacctaggctgacctcggccaagctacgc
ctgcctgcagcgtccgttaaagcgcgcgcatcggtgggttga

DBGET integrated database retrieval system