KEGG   Xanthomonas oryzae pv. oryzae PXO99A: PXO_03864Help
Entry
PXO_03864         CDS       T00763                                 

Definition
(GenBank) xylanase
Organism
xop  Xanthomonas oryzae pv. oryzae PXO99A
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ACD57010
UniProt: A0A0K0GG58
Position
367919..368095
Genome map
AA seq 58 aa AA seqDB search
MAAGMAAPAYAAPLASKAAKFLGSAHGAQQAPGFAQHWNKLTGKMAANGAVWKRCATR
NT seq 177 nt NT seq  +upstreamnt  +downstreamnt
gtggcggctggcatggcggcacctgcctacgccgcaccgctggcatcgaaggccgccaag
ttcctcggcagtgcgcatggcgcgcagcaggcgcctgggtttgcgcagcactggaacaag
ctcaccgggaaaatggcggcaaatggggcagtgtggaagcgatgcgcgaccagatga

DBGET integrated database retrieval system