KEGG   Xenopus tropicalis (western clawed frog): 100496674Help
Entry
100496674         misc_RNA  T01011                                 

Gene name
plcg1
Definition
phospholipase C, gamma 1
Organism
xtr  Xenopus tropicalis (western clawed frog)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
Position
Un
NT seq 5288 nt NT seq  +upstreamnt  +downstreamnt
agttcctttctgcttttaatcccactggaatctctatggattcatgttaagcaggatact
gcaaggatccattgggtgggtttgtattgattggtaactgatagggcactgactccctcc
cctgctgcatgatgggagcccccccccctgagtgaggctttggtaggtgcataaggctgg
atatctgcaagagatctgcagcaggagaatatgaggaggcagacttcctgagtgagtgtg
tgagtgcagattgtttcactgtgatctctgcctgcccaggaggggggaagaagaagagaa
ggaggaggaggaggaggagggaggcagatctcagctctcagtttataacaatagaggggg
tggaaatgtgtttgctagcccactcctcacaccagtctcgggtttgattccacagccact
tgctgctttgcattgtcctcccatggcagggggagccctgacctgctcggaggaacccgg
cctctgattcttcttcttcttccctgacttgctggagggacctcagggggcagcatggaa
tccctgccgcttctcaatgggttcgctccatgtgggcaaagtgaagccgagctcacccat
ctgtgccggagtttggaggtgggcaccgtcatgaccctcttctactccaagaagtcccag
aagccggagaggaggactttccaggtgaagctggagaccaggcaggtgacatggagcaga
gtggcggataaagtggaaggggcagtggatattcgggaaattaaggagattcgacctagc
aagaactccagagatttcgaccggtaccaggaggacccaacggtgcggttggagcaggct
cattgcttcgttatattgtacggaacagagttcagactgaagaccttgagcctacaagcc
acctccgaggaggaagtaaacatgtggattaaagggttaaactggctgcttcaggataca
ctgcaggcgcctactcctctgcagattgagaggtggctccggaagcagttctacacattg
gaccgcaacagggaagacaagatttctgtcaaagacctaaagaatatgctgtcccaggtt
aattacagggtccccaatatgaggttcctgcgtgaccgactaatggaactggaacaaaga
agccgagagattaactatgcccagtttgccatactctaccgatcccttatgtatgatgca
cagaaaacgatcccaattccctttacagagagaaatactttctttttcaccaggtttggt
gagcgtgaaaggaccaaagtatccctagaggacttccaaaagttcttgctggattatcaa
aaggagatgtgggcaactgatctgcacaaagtgcgggagttcatgttccacttcctgcat
gaccctttgagggagatcgaagagccatatttcactctggaagagtttgtatctttcctg
ttctctaaggagaatacagtgtgggattcagaactggacacagtgtgtccccaaaatatg
gacaaccctttgtctcattactggatatcctcttcccacaacacgtacctaacaggggat
cagttctccagtgaatcttcattggaagcctacgctcgctgcctgcgcatgggctgtcgc
tgcatagaattggactgctgggatgggccagatggaatgccagttatttaccatgggcat
acgctgaccaccaaaataaagttctccgaagtcttaaccaccatcaaggaacatgctttt
gtcacatcagaatacccagttatcttatcaattgaagaccactgcagcattgcacaacaa
agaaatatggctcagcactttaagaaggtttttggggacatgctcctgaccaagcccgtg
gatgtcaacgctgatggccttccctctcccaaccaactgaaacggaaaatcctcatcaag
cacaagaagctggcagaagggagcacttatgaagagataccggcctccactgtctactcg
gaaaatgacatcagcaactccatcaagaatggaattttgtacctgcaagatcccatcaat
cacgagtggtacccacatttctttgtcctcaccagcagcaagatctattattcagaggag
accaccggcagccaggctaacgatgacgaggaggaacagaaggaggccagtaacagctca
gagctgcactctgctgaaaagtggttccacgggaagctgggtgcaggaagggatggacgg
cacattgcagaacggctgctgacagattactgtattgaaactggggctccagatggctcc
tttctggtgcgggagagtgagacatttgtgggggattacacactctccttctggagaaat
ggaaaagttcagcactgtaggatacactccaggcaagaagctggtagtccgaaattcttc
ctgacagataatctggtgtttgagagtctgtatgctctgattactcactaccagcaaatg
cccctgaggtgcaacgagtttgagatgagactgacagagccggttccacagactaatgcc
cacgagagcaaggagtggtatcatgccagccttacccgggggcaagcagaacacatgttg
atgagagttccccgagacggagccttcttggtgcgcaagaggagtgaacagaactcatat
gccatctccttcagagccgaggggaagatcaaacactgccgggtaatacaggaaggtcaa
agcgttgtccttggaagctcagagttcgacagcctggtggatttaataagttactatgag
aagcaccctctgtatcggaagatgaagctgcgttaccccattaatgaagaaacgcttgaa
aagatcggcacccctgatccagattatggtgctttatacgagggaaggaatcctggtttc
tatgtggaggccaatccaatgcctacatttaagtgctctgtcagggccttgtttgattat
aaggctcaacgtgaggatgaattgactttcaccaagaatacaatcatccagaacgtagag
aagcaagagggaggatggtggcgaggcgactgcgggggtaaaaagcagatgtggttccct
gccaactacgtggaagagatatttagtccagctgagcctgagcctgagagacagcatctg
gatgagaacagtcctctaggagatcttctgggtggagttttggatgtgccgtcctgtcac
attgttcctcgaccagatgtctttaatggtcgaccctttgtattcaccattaccgggcct
cagttgaatcgatatccacttgacgttgctgcggacacaatggaagacatgcaagactgg
ataagaaaaattcgggaagccgctcagactgcagatgcacggctcacggaaggcaaaatc
atggagcgcaggaagaagattgccctggaactctcagaacttgtcatctactgccggcca
gttccctttgacgaagagaagattggcactgagaaggcctgttaccgtgacatgtcctcc
ttccctgagaccaaagcagaaaagtatgtcaacaagttgaaagggaagaaatttctacag
tacaaccggcggcagctatctcgtatctatcccaaaggacaacgtcttgattcatcaaac
tatgatcccctgccaatgtggatctgtggcagtcaacttgtagcgctcaacttccagact
ccagacaaacccatgcaaatgaaccaggctcttttccactccgggggtcgttgcggttat
gtttttcagccaagtagcatgagggatgaaatgttcgatccatttgacaaaggcacccta
cgccaggagacaataaccatcagcattgagatcctaggtgcccgccatctgcccaagatt
ggaaggggtattgtctgcccttttgtggaggtagaagtttgtggtactgaatatgacaat
gcaaagcagaagacagaatttgtagtggataatggcttgaatcccatctggccacagaaa
accttcccctttgtcgttgctaaccccgagtttgctttcctacggtttgtggtctatgaa
gaggacatgtttagtgatcagaacttcttggcccaagcctcgtttgtggtccgtggcttg
aaaacaggatatagagccatcccactcaaaaataattacactgaggatctggaactggca
tcactgctcattaagatagacatcaagaccgagaacggagaacttaatggagcttctgca
cccagggaacggatcagtgaccctatgtctgggcgcatttgggatgggccgacagacacg
cgatatcattccaaccatctggatgatttccgtgcctcgaacaatttgaaagagaaagga
gagtcctcaggaaaacgcgtctaagtggggataaccggctgtagagtacgaactcaagta
cttctgacggattatttgggaagatccaacctttgttcctcacgtggcgggggacgtaca
tgggttggagcaccatggtgacctctatttgaacacgttgaatttagaatacgtgcttcc
acagtgactttgtgtgggaacattttgttcaaatatcgcaatcgtttccggaaagggaac
tattaacctacagcacagactctagaaatatatatataatgccttgtatattggtagggc
aactagcaaaggctgggttattctctactatccagcttaaaatggacagcctcttgcttc
tctgtttagtaaccgtctgctatcaaactgtgaaaagagaggatgcaaagacatctcaga
ttttgtaatccaaccttcgtcaccctgacctgagatttcaacgctacgtgactttatagg
gaccggaacattgatcttgacttctttatttctatttgcaacatcattccacggatcgag
catctcgtcttgcgttctttttttattttgtcgtcatgtaccacaaacaagcacaagaac
ggatgatttgggccaaattgtggctctcgtcaggtgggaagtgaaatgccatggtggcct
tcaattcagtgtcacaaaaatccttaatgcacttcagtggactgtttatacgttttactg
ctctggaatgaaacaagtctgccatgacagtgagaagcctacagtgtctggtgattaatg
gcaccaaactcattaaaacgccaataattcagaaacctgggaggaggaggagcctgttac
agtgggcgccaaggtgcagttccactacgtcttcaatatatttcctatttatgtgcaata
tataaagtctgttttcattttctcatttttttttttttttttttttaaataaactataat
ccgactga

DBGET integrated database retrieval system