KEGG   Yersinia enterocolitica subsp. palearctica 105.5R(r): YE105_Cp0034Help
Entry
YE105_Cp0034      gene      T01480                                 

Definition
(GenBank) pseudogene
Organism
yep  Yersinia enterocolitica subsp. palearctica 105.5R(r)
SSDB OrthologParalogGene clusterGFIT
Position
2431525..2432044
Genome map
NT seq 520 nt NT seq  +upstreamnt  +downstreamnt
gtggaagccaaacccgcgcgtatcctgatcagtgcctgtttgataggcaaacctgttcgt
tataatggcagtgccctgtctgtccatcatgaaattattcagcgctggcaggatgaaggg
cggttggtcattgtatgtcctgaactggctgctggaatgccagtacctcggcctcctgct
gaaattcagcaaggtaatggtgaggcggtgttacaaggtcaggcccgggtgattgaacaa
tggggcaatgatgtcagccgggaatttctgcaaggggcttaccaggcattagcgttggcc
caaaaacatcagtgcaccttggccattctcactgagggtagcccgtcatgcgggagcagc
cgtatttatgatggccatttttaatggcacccaacgcacaggacagggcgtaactacggc
cttattgcgtcgccacggggtcactgtattcagtcatctccaacttgaacaggcggatga
ttttttgcgaagtggttcacagattcaggttgaaaattaa

DBGET integrated database retrieval system