KEGG   Yersinia pestis KIM10+ (biovar Mediaevalis): y0289Help
Entry
y0289             CDS       T00092                                 

Definition
(GenBank) hypothetical
Organism
ypk  Yersinia pestis KIM10+ (biovar Mediaevalis)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
Position
309936..310085
Genome map
AA seq 49 aa AA seqDB search
MKIAYRTIRFINLWIYAVFYSEFFGFELSHYLSTADMIFFGDYEFILYH
NT seq 150 nt NT seq  +upstreamnt  +downstreamnt
atgaaaattgcttatcgaacaatacgctttataaatttatggatatatgctgttttctac
agtgagttttttgggttcgaactgtcacattatctttccactgccgatatgatttttttt
ggtgattatgagtttattttatatcactaa

DBGET integrated database retrieval system