KEGG   Yersinia pestis KIM10+ (biovar Mediaevalis): y0302Help
Entry
y0302             gene      T00092                                 

Definition
(GenBank) pseudogene
Organism
ypk  Yersinia pestis KIM10+ (biovar Mediaevalis)
SSDB OrthologParalogGene clusterGFIT
Position
321789..323029
Genome map
NT seq 1241 nt NT seq  +upstreamnt  +downstreamnt
atgtccagatgtattgacgtccgtaatttgtgcgtctactctggcgtaacattttctcga
tcccggctggtggaaatcaatatgacgcgtaaacaggcaacaatagcagtccgtagcggg
ttgaatgatgacgagcaatacggctgcgttgtccccccgattcacctttccagtacctac
aattttattgattttaatcagccgcgcacgcatgactattcacgtcgtggtaatccaacg
cgtgatgttgtccaacgggcgctggcggaattggaagggggggccggtgccgtcatgacc
agcagcgggatgtcggcgcttcatttggtttgcactacattcttacagccgggcgatctg
ttggtcgctccgcatgactgttacggtggcagttaccgtttatttgacagcttgagcaag
cgtggtgcgtatcgggtgttatttgttgatcagggcgatgaagcggcactaaactgcgca
ttggcggagaaaccgaagttggtcttgattgaaacaccgagtaatccattgctacgggtt
gttgatattgccgccatctgccaagccgcccgtgctgcgggcgcactgacggtttgtgat
aacaccttcctcagccccgccttacagcagcctctctctcttggggccgatttagtggtg
cactcctgtaccaaatatctcaatggtcactctgatgtggtggctggtgctgttattgcg
aaagatccagaactggttgtcgagctggcatggtgggcaaataatattggtgtaaccggt
gctgcgtttgacagctatctactccttcgtggtttacgcacgttatcaccacgcatggct
caacagcagcgtaacgcggatgacattgtgcgttatttacagcaacagcctttagtgaaa
aagctgtatcatccttccctgccacaacatcccggccacgaaatagcctgccgtcagcaa
tcaggttttggtgcaatgctcagttttgagctggatggtgatgagcaggtcatgcgccgt
ttcctttctgcccttgagctatttaccttggcagagtctttgggggggtagaaagcctga
tctcccatgcagcgaccatgacccacgcgggtatggcggcagaggcgcgtattgccgcag
gcattactgatagtttgttgcgtatttccgtgggtattgaagacagtgaagatttgattg
ctgatttggaccacgcgttccaattggcagtaacgaggtaa

DBGET integrated database retrieval system