KEGG   Yersinia pestis KIM10+ (biovar Mediaevalis): y0343Help
Entry
y0343             gene      T00092                                 

Definition
(GenBank) pseudogene
Organism
ypk  Yersinia pestis KIM10+ (biovar Mediaevalis)
SSDB OrthologParalogGene clusterGFIT
Position
complement(378834..379789)
Genome map
NT seq 956 nt NT seq  +upstreamnt  +downstreamnt
ttggaagccgttaacaacataaaaggaatttatattatgttagaaaccaccaaatcaacg
gtacaggcgttatattttccctgtactgtatttaaaacccaaaaacgtatggatgattac
ggtgccgatgatatgcggtgtggtgatctaagcgcaacacagttaaaaacagattttaat
gtggtgatctaagcgcaacacagttaaaaacagattttaatctgcataatatttcaagca
aggttaacccgtacacgctaacgttgttccaacagctaaagcccatgccttatggttatg
cttatgataaaaatcctgagagcaaaaagataacacggcaggaatgtgtcaggatcctct
ttaatgaatttcgccacgaatcacgaagttttgctttttatggcccatataaacacctga
tcgaaaaaatgatcgaccatatgcagaatggcaacggcacaccgtttcgggatctgtctt
tagatgccgcattgaaagagcaaatactgagtgattacacagaaaaaaacagtacgcgcc
tgctgttgagaaaagtcctaaatgaaaatatagactggagaaataagctgtatccagcag
aaaaaaaagatgacataagaaaatttattcttgatggtagacttccaaaattcgatagat
ttcaggataactttaatggaatggggatcaccgttcacgatacctgggccacggatatca
cgataaaatcattgcagatcgacaatgaccgttatcgcgcgatggtgcattacaaaatac
aggatcacttcgggctggataataatgatattaagaataccaagtttaaccggtttcatt
tcttccgcatatggtttgtcctccaacgattcaaccagtttggtttcaagccatttatga
ctaatatggaagccacaatagagattaccgggggccgtaatgaaagcaaaaagtaa

DBGET integrated database retrieval system