KEGG   Yersinia pestis KIM10+ (biovar Mediaevalis): yr007Help
Entry
yr007             rRNA      T00092                                 

Definition
(GenBank) 5S ribosomal RNA
  KO
K01985  
5S ribosomal RNA
Organism
ypk  Yersinia pestis KIM10+ (biovar Mediaevalis)
Pathway
Ribosome
Brite
KEGG Orthology (KO) [BR:ypk00001]
 Genetic Information Processing
  Translation
   03010 Ribosome
    yr007
Ribosome [BR:ypk03011]
 Ribosomal RNAs
  Prokaryotes
   yr007
Non-coding RNAs [BR:ypk03100]
 Ribosomal RNA
  Large subunit rRNA
   yr007
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
360950..361069
Genome map
NT seq 120 nt NT seq  +upstreamnt  +downstreamnt
tgcctggcggccatagcgcggtggtcccacctgatcccatgccgaactcagaagtgaaac
gccgtagcgccgatggtagtgtggggtctccccatgcgagagtaggacactgccaggcat

DBGET integrated database retrieval system