KEGG   Yersinia pestis KIM10+ (biovar Mediaevalis): yt003Help
Entry
yt003             tRNA      T00092                                 

Definition
(GenBank) tRNA-Glu
  KO
K14224  
tRNA Glu
Organism
ypk  Yersinia pestis KIM10+ (biovar Mediaevalis)
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:ypk00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    yt003
Non-coding RNAs [BR:ypk03100]
 Transfer RNA
  tRNA
   yt003
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
357608..357680
Genome map
NT seq 73 nt NT seq  +upstreamnt  +downstreamnt
gtccccatcgtctagaggcctaggacactgccctttcacggctgtaacaggggttcgaat
ccccttggggacg

DBGET integrated database retrieval system