KEGG   Yersinia pestis KIM10+ (biovar Mediaevalis): yt009Help
Entry
yt009             tRNA      T00092                                 

Definition
(GenBank) tRNA-Pro
  KO
K14232  
tRNA Pro
Organism
ypk  Yersinia pestis KIM10+ (biovar Mediaevalis)
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:ypk00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    yt009
Non-coding RNAs [BR:ypk03100]
 Transfer RNA
  tRNA
   yt009
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
420366..420439
Genome map
NT seq 74 nt NT seq  +upstreamnt  +downstreamnt
cggcgagtagcgcagcttggtagcgcaactggtttgggaccagtgggtcggaggttcgaa
tcctctctcgccga

DBGET integrated database retrieval system