KEGG   Yersinia pestis A1122: A1122_t21151Help
Entry
A1122_t21151      tRNA      T01831                                 

Definition
(GenBank) tRNA-Tyr
  KO
K14236  
tRNA Tyr
Organism
ypt  Yersinia pestis A1122
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:ypt00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    A1122_t21151
Non-coding RNAs [BR:ypt03100]
 Transfer RNA
  tRNA
   A1122_t21151
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
3321554..3321638
Genome map
NT seq 85 nt NT seq  +upstreamnt  +downstreamnt
ggtggggttcccgagcggccaaagggagcagactgtaaatctgccgtcatcgacttcgaa
ggttcgaatccttcccccaccacca

DBGET integrated database retrieval system