GenomeNet

>mtu:Rv2069 K03088 RNA polymerase sigma-70 factor, ECF subfamily | (RefSeq) sigC; ECF RNA polymerase sigma factor SigC (N)
atgaccgcgacggcaagcgacgacgaggccgttaccgcactcgccttgtcggcggccaag
gggaacgggcgggcccttgaggcgtttatcaaagccacccagcaagacgtgtggcggttc
gtcgcctatctgtccgacgtgggcagtgcggacgatctcacccaagagacattcctacga
gcgatcggcgccatcccgcggttttccgcacgctccagcgcccgaacttggttgctggcc
atcgcgcgccatgtcgtcgccgatcacatccgccacgtccgatcccggccccgcaccacc
cgcggcgcgcgtcccgaacatctcatagacggcgaccgccatgcccgcggattcgaagac
ctcgtcgaggtaaccacgatgatcgccgacctaaccaccgaccaacgggaagcgctgctg
ctgacccagctgctcgggctgtcctatgcggacgccgcggcggtgtgcggctgcccggtg
ggcaccatccgatcccgtgtcgctcgagcgcgcgatgcgctgcttgccgacgcggagccc
gacgacctcaccggctag

BLAST