GenomeNet

>mtu:Rv2710 K03087 RNA polymerase nonessential primary-like sigma factor | (RefSeq) sigB; RNA polymerase sigma factor SigB (N)
atggccgatgcacccacaagggccaccacaagccgggttgacagcgatctggatgctcaa
agccccgcggcggacctcgtgcgcgtctatctgaacggcatcggcaagacggcgttgctc
aacgccgccggtgaagtcgaactggccaagcgcatagaagccgggttgtatgccgagcat
ctgctggaaacccggaagcgcctcggcgagaaccgaaaacgcgacctggcggccgtggtg
cgtgatggcgaggcggcgcgccgccacctgctggaagcaaacctgcggctggtggtatcg
ctggccaagcgctacacgggtcggggcatgccgttgctggacctcatccaggagggcaac
ctgggtctgatccgagcgatggagaagttcgactacacaaagggattcaagttctcaacg
tatgccacgtggtggatccgccaggccatcacccgcggaatggccgaccagagccgcacc
atccgcctgcccgtacacctggttgagcaggtcaacaagctggcgcggatcaagcgggag
atgcaccagcatctgggtcgcgaagccaccgatgaggagctcgccgccgaatccggcatt
ccaatcgacaagatcaacgacctgctggaacacagtcgcgacccggtgagtctggatatg
ccggtcggctccgaggaggaggcccctttgggcgatttcatcgaggacgccgaagccatg
tccgcggagaacgcggtcatcgccgaactgttacacaccgacatccgcagcgtgctggcc
actctcgacgagcgtgagcaccaggtgatccggctgcgcttcggcctggatgacggccaa
ccacgcaccctggatcaaatcggcaaactattcgggctgtcccgtgagcgggttcgtcag
atcgagcgcgacgtgatgagtaagctgcggcacggtgagcgggcggatcggctgcggtcg
tacgccagctga

BLAST