KEGG   Acidovorax avenae: Acav_2102Help
Entry
Acav_2102         CDS       T01445                                 

Definition
(GenBank) type IV pilus assembly PilZ
Organism
aaa  Acidovorax avenae
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: PilZ
Motif
Other DBs
NCBI-ProteinID: ADX46014
UniProt: F0Q9U9
Position
complement(2345752..2346159)
Genome map
AA seq 135 aa AA seqDB search
MAHERRHYVRVAFEAPARLAVSGHGTFDVQVLDVSLRGALLELPAGQALPPGAPCALSIP
LMAGEEQIAMSGELVHVEGHCAGLQGHTMDLDSATHLRRVIELQLGDPALLERDLQTLVS
AHRGRGVPAQPATGH
NT seq 408 nt NT seq  +upstreamnt  +downstreamnt
atggcccatgaacgccgccactatgtccgagtcgccttcgaggcgcccgcgcgccttgcc
gtgagcggccacggcaccttcgacgtgcaggtgctggacgtgtccctgcgcggcgcgctg
ctggagctgcccgccggccaggccctgccgccgggcgccccctgcgcgctctccattccc
ctgatggcgggtgaggagcagatcgcgatgtccggcgaactggtgcacgtggaaggccac
tgcgcgggcctgcagggccacaccatggacctcgacagcgccacccacctgcgccgcgtg
atcgagctgcagctcggcgacccggccctgctggagcgcgacctgcagacgctggtgtcg
gcgcaccgcggccggggcgtgccggcgcagccggcgaccgggcactga

DBGET integrated database retrieval system