KEGG   Alicyclobacillus acidocaldarius subsp. acidocaldarius Tc-4-1: TC41_T046Help
Entry
TC41_T046         tRNA      T01821                                 

Definition
(GenBank) tRNA-Val
  KO
K14237  tRNA Val
Organism
aad  Alicyclobacillus acidocaldarius subsp. acidocaldarius Tc-4-1
Pathway
aad00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:aad00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    TC41_T046
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:aad03100]
    TC41_T046
Non-coding RNAs [BR:aad03100]
 Transfer RNA
  tRNA
   TC41_T046
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(2205632..2205703)
Genome map
NT seq 72 nt NT seq  +upstreamnt  +downstreamnt
gcggctgtagctcagagggagagcactaccttgacacggtaggggtcacaggttcgattc
ctgtcagccgca

DBGET integrated database retrieval system