KEGG   Paenarthrobacter aurescens: AAur_0788Help
Entry
AAur_0788         tRNA      T00447                                 

Definition
(GenBank) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
aau  Paenarthrobacter aurescens
Pathway
aau00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:aau00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    AAur_0788
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:aau03100]
    AAur_0788
Non-coding RNAs [BR:aau03100]
 Transfer RNA
  tRNA
   AAur_0788
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(822845..822934)
Genome map
NT seq 90 nt NT seq  +upstreamnt  +downstreamnt
ggtgacgtgtccgagcggccgaaggtgcaacactcgaaatgttgtttggtgtaaaagcca
acgtgggttcaaatcccaccgtcaccgcca

DBGET integrated database retrieval system