KEGG   Acinetobacter baumannii ACICU: ACICU_tRNA39Help
Entry
ACICU_tRNA39      tRNA      T00710                                 

Definition
(GenBank) tRNA-Asn
  KO
K14220  tRNA Asn
Organism
abc  Acinetobacter baumannii ACICU
Pathway
abc00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:abc00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    ACICU_tRNA39
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:abc03100]
    ACICU_tRNA39
Non-coding RNAs [BR:abc03100]
 Transfer RNA
  tRNA
   ACICU_tRNA39
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
2950039..2950114
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
tctcccatagctcagtcggtagagcgacggactgttaatccgcaggtccctggttcgagc
ccaggtgggagagcca

DBGET integrated database retrieval system