KEGG   Alicycliphilus denitrificans K601: Alide2_1920Help
Entry
Alide2_1920       CDS       T01463                                 

Definition
(GenBank) conjugative transfer region lipoprotein, TIGR03751 family
Organism
adk  Alicycliphilus denitrificans K601
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AEB84298
UniProt: F4G754
Position
2020155..2020589
Genome map
AA seq 144 aa AA seqDB search
MRRIWIESAAILCAVLVLGGCATSKDKLLPHGDRTMLDVWNQETGGSAGGGQAARQLLDA
RQDLRRPLTEADVQAAPAAAAAYTRTAANEIYRQFRRLPNPDLVMYVFPHLAGTDPVPVP
GYTTVFPLYQRVQYAMPGERLEDY
NT seq 435 nt NT seq  +upstreamnt  +downstreamnt
atgcgtcggatttggattgaatcggccgcgatcctgtgcgcggtcctggtgctgggcggc
tgcgccaccagcaaggacaaattgctgccgcacggcgatcgcaccatgctcgacgtgtgg
aatcaggagacgggcggcagcgccggtggtgggcaggcagcgcggcaactgctcgatgca
cgccaggacttgcgccggccgctgaccgaggccgacgtgcaggcggcgcccgccgccgct
gccgcctacacgcgcaccgcggccaacgagatttaccgccagttccggcgcctgccgaac
ccggacctggtgatgtacgtgttcccgcacctagccggcaccgacccggtgcccgtgccc
ggctacaccaccgtgttcccgctctaccagcgcgtgcagtacgcgatgcctggcgagcgc
ctggaggactactga

DBGET integrated database retrieval system