KEGG   Aeromicrobium erythreum: AERYTH_10360Help
Entry
AERYTH_10360      gene      T04236                                 

Definition
(GenBank) pseudogene
Organism
aer  Aeromicrobium erythreum
SSDB OrthologParalogGene clusterGFIT
Position
complement(2207018..2207344)
Genome map
NT seq 327 nt NT seq  +upstreamnt  +downstreamnt
gaccaggcgatcgacaacgccggctccggcgcgacgatcgaccgtgacgcggcccgtatc
ggcgccatcggcgccgtcgtcttcggcctgatcatcggcgtcggcctcgcggcgctgttc
gcctacttcatcggcaagggcgccaactgggcgcgcatcgtctacacggtcctcatcgtg
atcggcgtgctcgggtcgctggcgcagctgggcggccagccgcccgtcctgctggtgctc
tcgctcgtcagcctcgcgatcggcatcgccatcgtcgtcttcctctaccgccccgactcg
aacgcgtacttcaagaagaaggcctga

DBGET integrated database retrieval system