KEGG   Acidithiobacillus ferrooxidans ATCC 53993: Lferr_R0055Help
Entry
Lferr_R0055       rRNA      T00758                                 

Definition
(GenBank) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
afe  Acidithiobacillus ferrooxidans ATCC 53993
Pathway
afe03010  Ribosome
Brite
KEGG Orthology (KO) [BR:afe00001]
 Genetic Information Processing
  Translation
   03010 Ribosome
    Lferr_R0055
Ribosome [BR:afe03011]
 Ribosomal RNAs
  Prokaryotes
   Lferr_R0055
Non-coding RNAs [BR:afe03100]
 Ribosomal RNA
  Large subunit rRNA
   Lferr_R0055
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(2666090..2666205)
Genome map
NT seq 116 nt NT seq  +upstreamnt  +downstreamnt
tctggcggccatagcgcagtggaaccaccccttcccatctcgaacaggaccgtgaaacgc
tgcagcgcctatgatagttgagggtctccctccgcgaaagtcggtcaccgccagac

DBGET integrated database retrieval system