KEGG   Ashbya gossypii (Eremothecium gossypii): AGOS_AgSNRNME1
Entry
AGOS_AgSNRNME1    ncRNA     T00167                                 

Definition
(RefSeq) AgSNRNME1
  KO
K14576  small nucleolar RNA MRP
Organism
ago  Ashbya gossypii (Eremothecium gossypii)
Pathway
ago03008  Ribosome biogenesis in eukaryotes
Brite
KEGG Orthology (KO) [BR:ago00001]
 09120 Genetic Information Processing
  09122 Translation
   03008 Ribosome biogenesis in eukaryotes
    AGOS_AgSNRNME1
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03009 Ribosome biogenesis [BR:ago03009]
    AGOS_AgSNRNME1
  09184 RNA family
   03100 Non-coding RNAs [BR:ago03100]
    AGOS_AgSNRNME1
Ribosome biogenesis [BR:ago03009]
 Related small nucleolar RNAs
  Other snoRNA
   AGOS_AgSNRNME1
Non-coding RNAs [BR:ago03100]
 Small non-coding RNA
  Small nucleolar RNA
   AGOS_AgSNRNME1
SSDB
Other DBs
NCBI-GeneID: 4620030
Position
IV:complement(339273..339560)
NT seq 288 nt   +upstreamnt  +downstreamnt
aaggcatgtccgaagaatcgtcacaatcgaagcttaccaaggccggcagctagctgccgg
tccgccatgctttggggaaagtctccgaccaggctgtatgcggaaacgcagcgagattta
aaaacttatttttacatccactcgctagggctgcctggcagccctttctcctggggcgca
agctccagtgactttcggtagcggggccctgtgggcgccgagcgatagttatgacgattg
cgcaccgcgtaacgcaatggagcttattctcgggccatgccttcggcc

DBGET integrated database retrieval system