KEGG   Alteromonas mediterranea U8: I634_t19485Help
Entry
I634_t19485       tRNA      T02722                                 

Definition
(GenBank) tRNA-Tyr
  KO
K14236  tRNA Tyr
Organism
amao  Alteromonas mediterranea U8
Pathway
amao00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:amao00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    I634_t19485
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:amao03100]
    I634_t19485
Non-coding RNAs [BR:amao03100]
 Transfer RNA
  tRNA
   I634_t19485
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(3846071..3846155)
Genome map
NT seq 85 nt NT seq  +upstreamnt  +downstreamnt
ggaggggtacccaagcggtcaacgggagcagactgtaaatctgccggctcagccttcgca
ggttcgaatcctgccccctccacca

DBGET integrated database retrieval system