KEGG   Agrobacterium radiobacter: Arad_5013Help
Entry
Arad_5013         tRNA      T00850                                 

Definition
(GenBank) tRNA-Pro
  KO
K14232  tRNA Pro
Organism
ara  Agrobacterium radiobacter
Pathway
ara00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:ara00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Arad_5013
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:ara03100]
    Arad_5013
Non-coding RNAs [BR:ara03100]
 Transfer RNA
  tRNA
   Arad_5013
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
1:1411002..1411075
Genome map
NT seq 74 nt NT seq  +upstreamnt  +downstreamnt
cggggcgtagcgcagcccggtagcgcacttgactgggggtcaaggggtcgcaggttcaaa
tcctgtcgccccga

DBGET integrated database retrieval system