KEGG   Aeromonas salmonicida subsp. salmonicida A449: ASA_1785Help
Entry
ASA_1785          tRNA      T00500                                 

Gene name
trnS
Definition
(GenBank) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
asa  Aeromonas salmonicida subsp. salmonicida A449
Pathway
asa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:asa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    ASA_1785 (trnS)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:asa03100]
    ASA_1785 (trnS)
Non-coding RNAs [BR:asa03100]
 Transfer RNA
  tRNA
   ASA_1785 (trnS)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
1866847..1866934
Genome map
NT seq 88 nt NT seq  +upstreamnt  +downstreamnt
ggtgaggtgtccgagtggctgaaggagcacgcctggaaagtgtgtatacggcaacgtatc
gagggttcgaatccctccctcaccgcca

DBGET integrated database retrieval system