KEGG   Aeromonas salmonicida subsp. salmonicida A449: ASA_1807Help
Entry
ASA_1807          tRNA      T00500                                 

Gene name
trnU
Definition
(GenBank) tRNA-Sec
  KO
K14238  tRNA Sec
Organism
asa  Aeromonas salmonicida subsp. salmonicida A449
Pathway
asa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:asa00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    ASA_1807 (trnU)
Non-coding RNAs [BR:asa03100]
 Transfer RNA
  tRNA
   ASA_1807 (trnU)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(1890712..1890799)
Genome map
NT seq 88 nt NT seq  +upstreamnt  +downstreamnt
ggaagttgatggggtctggtggcctcctcggtcttcaaaaccgatgtgagccgagaaggc
tttggcaggttcgattcctgcctcttcc

DBGET integrated database retrieval system