KEGG   Aeromonas salmonicida subsp. salmonicida A449: ASA_1817Help
Entry
ASA_1817          gene      T00500                                 

Definition
(GenBank) pseudogene
Organism
asa  Aeromonas salmonicida subsp. salmonicida A449
SSDB OrthologParalogGene clusterGFIT
Position
complement(1901503..1904339)
Genome map
NT seq 2837 nt NT seq  +upstreamnt  +downstreamnt
ttgctaattccattaggcacatcactcctgaataaagtaaattatagccacctagttttc
ccttggtcagaaaataatgggccttattatacatttatatttggtctaatgctttgctta
gctcctgttatagttttagcttattggtttttctgtggagataaagatcctgacactaag
aaaatatcatgggaattttttagaatagactctcaggaaaactacacacaagatattaca
gaggatggagaaagaacctctattgaatttgaggattatttcaggcaaataataaatacg
gcaataaaaaaccataatatcgaaaaaattataatcgtcatagataatttggatagagta
acaccagagcacgctaaaaatgtatggtctaccttacaaacatttttccagcggctctct
acaacaggcacaactgaaacttggcctgaccaagtttggtttatagtgccatttgataga
gatggatttaaaaaaatatggaactcagatgacaatgacaaaaaaatctctgattccttt
ttaaaaaaatgttttcagttggttgcggaagtcccacatcctgtaatgtctggttggtcc
caatatgttgaaaaatgtattaatctttcattacataaatggccattagatgaaaaaaaa
aagttgtatcaacatatatacgctatgcaagccgccttgataaatcaccaacacctagag
acataaggatatttgtgaatcaagtcggcctactcggttccatgtggggaaacgagactt
ctgttgaagccatgagcttatatgttttattaagagaaaattcttcaaccgatcaactaa
gatcatctttaatcagcaatgatgcactaggtaattatcaaccagatacagaacgctctg
ttttattgccccagctcgctggtttgctgtttggggtcaattctaataagggccttcagt
tgctacttgctcctgagattcattccgcatttaaaactggtgatggcaacgctcttaaaa
aactatctcaagatcataacaatgccttctggatagcttatgaagcatcgaaggatttat
gggaattgacgatgaaaaagactgatgattataagtattcattcaccaccgcattatttc
taggtctagtaaatagcagacataaaataaaaagagaaataaattgccttcctaagatat
ggatagattcatatccaagtctcaattttgatagtaatgattattcgagcgtaataaatt
acacattccagctatgtggagataataactttcttaaaaagatcaaagaactcacaactg
aaaagatttcacaagaaatttcaaaaatcgataatgaagcattctcagtgaaggtttttc
gcaatctactgtccttaattgagttattaaaagaacaccagtataaaatagaaccaaaag
tcaatcctaagttaaattgtaaaaattggatgttatggcttgaaaagattaacgatgaaa
aaatatcattcaatcttgttttacctaaaaaacaagcaattatagacctagcaaatgaag
ttcaattctcatactcaaagttagaagaccaagcgttagaccatcttattcaaacgtata
aaatacatccaacatctaacgaatgggatgaagtaactaatagcattgttagttggctca
atatgtctaatcgtgatgttgattgtgagaaaatatatgattttgcacttaagctagtta
tcggcgataatgataaaatttcagataaaattaccaattgtattgatgggagtgacttct
ggtataacatggaagacgcctcaatatcaaaaaaaccctctcttccaattttgacagcat
tatccattcagcagaaattacaaaatcatgattttgtttcttctgcggtgaaatcatact
ggaataattcaatagacaagaactctacagatgagatatataataaacttaaagaaataa
atagcttgtatgtcttgtggcttttatctagagactgcaataatgccgtagctatagaaa
tagtcaaaaaatatgtaacgcctgagttatatggtgatcttaatggtgtaagatttattg
atgagtttacatgggctgatgaaaaaaccatatcagaaatcgctcacaatcttattgtgc
atggtgcattcattaaaaatcaacctgatatggtagacagggcgactatttatgataagg
tttatcaaattttttattcattaaatgataaaaacacctcgcactttatcgattcagaga
ctaataagctagctcaggaagcatggtataagtctattgagacaaatagtccgctaaccc
ttcttgtaaaagaaaagaatccacatttttcagatgctctatgcaactatttaattaaga
ccatacaaggtgaagctaagaaacctcgaggttgggatttttctatagtttccggcttcg
ttgcaaaagtggcagatcttgaaaagacttttttacccgccattacagaatcatatttca
gtcatacgggtgataacttggatgctttagagtttaatactctttcaccatacttttcat
catatataaataaaataagcagtacccgaatcatgcaaaaaataaatctttggctggata
ataaccagtgggataaaatagagtggctattttcccacaatattattttcaacgaggccc
ctttagaaagtttgattggtagaatccatctgtttatggaatcaaatgatgacaataaaa
tatccattgcaaatattatttgcaatggattaaatataattatagaaaagaaagatggct
tggttgaaactacataa

DBGET integrated database retrieval system