KEGG   Arabidopsis thaliana (thale cress): AT1G01046Help
Entry
AT1G01046         miRNA     T00041                                 

Gene name
MIR838
Definition
(RefSeq) microRNA ath-MIR838 precursor
Organism
ath  Arabidopsis thaliana (thale cress)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 6240410
MIPS: AT1G01046.1
TAIR: AT1G01046
Araport: AT1G01046
Position
1
NT seq 21 nt NT seq  +upstreamnt  +downstreamnt
ttttcttctacttcttgcaca

DBGET integrated database retrieval system