KEGG   Arabidopsis thaliana (thale cress): AT3G58795Help
Entry
AT3G58795         lncRNA    T00041                                 

Definition
(RefSeq) other RNA
Organism
ath  Arabidopsis thaliana (thale cress)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 5008093
MIPS: AT3G58795.1
TAIR: AT3G58795
Araport: AT3G58795
Position
3
NT seq 964 nt NT seq  +upstreamnt  +downstreamnt
tagtgttattaaatctacgaatcatacgaaaataaataaatacaaagaagaacaaaaaat
taaagatgacaagcacatagcattcaatacgaacgaagaagatttatccatatcaataat
cattaactgaattcacactttgaagctatctgaatcattcatatccagaaaataggtaga
tttgcaaattaattaccaagaagatactaaagtaagaaacgattaatcaaaatttatatg
gaatctaatactatgaagaatgagtgttttactataccgagtggtgaatcgcaaacggag
gcagattcgaggacgagaaacgcgaacctgacgaagataaaagggaggacgatagcgagc
agcagcagcaacagtaacaacgtgcgactagagaatctccgcgctgctaacgccgccgct
gcagccgcacatcctccgcttcctttaccgattccgacgccgggatttgatatcatctct
gatctccactatcagttcatcaaaaacaacaaccaaaaccaacagggatcgagaagaaga
agaagctcaatgacgaagatgtgatcaaaagcaaaacgcgaatccagtaggtcgagaggg
actgtttggtttttgatctgtacgacgggaataaaaaacaacattcaaagaggaatgaat
ttttctaaagaagccaagcggacatatgcttaccaaaataaatgcatttttgtaaaagat
aatatttcaccaatattattcctatcataatagtcacgagtttgtgaaaataattagtat
tcttttaaaaaagccaaaaccaatgccgcgttcatctccgcgggaatttagcacatagtc
tataaatgttttgtgtatgtatgtatagatgtataaattaatcatgtgtagttaataggg
taaaacgaattatggaaaactttacgataactaaaataaatattttactggtaaatggaa
agag

DBGET integrated database retrieval system