KEGG   Arabidopsis thaliana (thale cress): AT4G31730
Entry
AT4G31730         CDS       T00041                                 

Gene name
GDU1
Definition
(RefSeq) glutamine dumper 1
Organism
ath  Arabidopsis thaliana (thale cress)
SSDB
Other DBs
NCBI-GeneID: 829301
NCBI-ProteinID: NP_194901
MIPS: AT4G31730.1
TAIR: AT4G31730
UniProt: O81775 A0A178UXJ2
Position
4
AA seq 158 aa
MRPLSVQSKFEDVATSTSVNHHGVTPQSPWHSPVPYLFGGLAAMLGLIAFALLILACSYW
RLSSSGEEDGQNVDEEKESRSGDKAANGAYEEKFLVIMAGEDLPRYLATPAMKKCTCGGH
EGKMVISQEESVAKEEEKMREGEEEKVKDTGETTTTSH
NT seq 477 nt   +upstreamnt  +downstreamnt
atgagaccattgagcgtacaatcgaagtttgaagatgtggcaacgtcaacctccgttaat
caccacggagtgacgccgcaatcaccgtggcactcgccggttccttacctcttcggcggt
ttagcggcgatgctaggactaatcgcctttgctcttctcatcctcgcttgctcttactgg
cgcctgtcttcctccggcgaagaagatggtcaaaacgtagatgaagagaaagagagccgg
tctggagataaggcggcgaacggagcttacgaggagaagtttcttgtcataatggccgga
gaagatttgccgaggtatctggcgacaccggcgatgaaaaagtgtacgtgtggtggtcac
gagggtaaaatggtgatttctcaggaggaaagtgttgccaaagaggaagagaagatgaga
gaaggcgaagaagagaaagtgaaagataccggcgagacaactactacaagtcactaa

DBGET integrated database retrieval system