KEGG   Arabidopsis thaliana (thale cress): AT5G54225Help
Entry
AT5G54225         CDS       T00041                                 

Gene name
LCR83
Definition
(RefSeq) low-molecular-weight cysteine-rich 83
Organism
ath  Arabidopsis thaliana (thale cress)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 3771507
NCBI-ProteinID: NP_001032074
MIPS: AT5G54225.1
TAIR: AT5G54225
Araport: AT5G54225
UniProt: P82792
Position
5
AA seq 82 aa AA seqDB search
MKMESSKMLVVFTLMVLIAVSSDLVSGNFASGEASSQLCFNPCTPQLGNNECNTICMNKK
YKEGSCVGFGIPPTSKYCCCKT
NT seq 249 nt NT seq  +upstreamnt  +downstreamnt
atgaagatggaatcctcaaaaatgttggttgtattcaccctcatggttctcatcgcagtc
tcctccgatctagtctccggtaattttgcatccggggaggcttcgagtcaactgtgcttc
aatccttgcactcctcaacttggcaataacgagtgcaatacgatttgtatgaacaagaaa
tacaaagaaggttcttgtgttggttttggaattccccctacttccaaatattgttgctgt
aaaacttaa

DBGET integrated database retrieval system