KEGG   Trichormus variabilis: Ava_R0029Help
Entry
Ava_R0029         tRNA      T00277                                 

Definition
(GenBank) tRNA-Cys
  KO
K14222  tRNA Cys
Organism
ava  Trichormus variabilis
Pathway
ava00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:ava00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Ava_R0029
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:ava03100]
    Ava_R0029
Non-coding RNAs [BR:ava03100]
 Transfer RNA
  tRNA
   Ava_R0029
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
CyanoBase: Ava_R0029
CYORF: Ava_R0029
Position
complement(3175621..3175692)
Genome map
NT seq 72 nt NT seq  +upstreamnt  +downstreamnt
ggcggcatagccaagtggtaaggcagaggtctgcaaaacctccatcccccggttcaaatc
cgggtgccgcct

DBGET integrated database retrieval system