KEGG   Aliivibrio wodanis: AWOD_I_sRNA_054
Entry
AWOD_I_sRNA_054   misc_RNA  T03808                                 

Gene name
qrr
Definition
(GenBank) small RNA Qrr
  KO
K15851  quorum regulatory RNA Qrr
Organism
awd  Aliivibrio wodanis
Pathway
awd02020  Two-component system
awd02024  Quorum sensing
Brite
KEGG Orthology (KO) [BR:awd00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   02020 Two-component system
    AWOD_I_sRNA_054 (qrr)
 09140 Cellular Processes
  09145 Cellular community - prokaryotes
   02024 Quorum sensing
    AWOD_I_sRNA_054 (qrr)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:awd03100]
    AWOD_I_sRNA_054 (qrr)
Non-coding RNAs [BR:awd03100]
 Other RNA
  Unclassified
   AWOD_I_sRNA_054 (qrr)
SSDB
Position
1:complement(1083600..1083705)
NT seq 106 nt   +upstreamnt  +downstreamnt
tgaccctttaagccaaagggtcacctagccaactgacgttgttagtgaaatttactttca
catgaacaataaagccaaccgggatattgcggttggcttctttttt

DBGET integrated database retrieval system