KEGG   Azospirillum sp. B510: AZL_re12Help
Entry
AZL_re12          tRNA      T01169                                 

Definition
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
azl  Azospirillum sp. B510
Pathway
azl00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:azl00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    AZL_re12
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:azl03100]
    AZL_re12
Non-coding RNAs [BR:azl03100]
 Transfer RNA
  tRNA
   AZL_re12
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
RhizoBase: AZLre12
Position
pAB510e:complement(449968..450054)
Genome map
NT seq 87 nt NT seq  +upstreamnt  +downstreamnt
gcgcttgtggcggaattggtagacgcgctaggttcaggtcctagtggctgaaaggccgtg
ggggttcgagtccctccaagcgcacca

DBGET integrated database retrieval system