KEGG   Borrelia afzelii (Maryland): BafPKo_0202Help
Entry
BafPKo_0202       tRNA      T02093                                 

Definition
(GenBank) tRNA-Phe
  KO
K14231  tRNA Phe
Organism
bafz  Borrelia afzelii (Maryland)
Pathway
bafz00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bafz00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BafPKo_0202
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bafz03100]
    BafPKo_0202
Non-coding RNAs [BR:bafz03100]
 Transfer RNA
  tRNA
   BafPKo_0202
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
205976..206048
Genome map
NT seq 73 nt NT seq  +upstreamnt  +downstreamnt
gctgctgtagctcagttggtagagcataggactgaaaatccttgtgtcaggagttcgatt
ctcctcggcagca

DBGET integrated database retrieval system