KEGG   Borrelia afzelii (Maryland): BafPKo_0208Help
Entry
BafPKo_0208       gene      T02093                                 

Definition
(GenBank) pseudogene
Organism
bafz  Borrelia afzelii (Maryland)
SSDB OrthologParalogGene clusterGFIT
Position
209169..210908
Genome map
NT seq 1740 nt NT seq  +upstreamnt  +downstreamnt
atgaaaacgattaaaaaagatccagaattttataattcccttgctacattaaaaaaatac
ataatcaaatatatagaagaaaaggttttaaagtatagcatttcttcccaactttacaaa
ttaaaaaaacctgaaataattgaacttataaaaattagcaatgattatgaaaaggaaaaa
aatgtatcaaattcttcgcttgaagaatactactacaaaaaaactcaaaatgaaataatt
aaaaaatggatattagaaatagtaagaaataaaaatttcactcaaataagcaaagaaacc
aactttaacaccaaaaaactaggaataacatataaactaaaatctaacaattttttaaaa
ctaattgaaatacaaaataacccttattattctcaagaaaaaaaagacatttacaaacaa
attatattgaatttttctagcaatattaacattgacaacttagaacaaacaatagatatt
ctagtagctgtaagaaacaaaaataaatttaaaatattaaatattttaaataacaactta
aaaaatcaaaaagaaaaccaaaaagtttttaaatcaagcttaattaataaagaaagtaga
ctaataaaattaaaaagaatcctaatacttatatattggccagttggatgtttaagtaaa
aatatttttataaaaattttaataaaacattacaaatacttggaagaagaaattttagcg
ctaaaatacaattaaattttaaactatttacgcgcaataaaaactttaagtcttaatgaa
attttttacaaaggttcgagtaaaaatattaactttaattattttttcagcgattttaca
caatacaccccaaaggattttcaagacacattaaagtgttatttatttatagttgaaaaa
acaataacaaaaaaatatttaacttggtttttcaaagacaaagtatcgaataattgggaa
tctttcctatatgcacttgaatacattgaaaaacacaaattaatcaacataaaagaaaaa
atcaaagaaattataaccgcaaaattccaaacagaagatttttttacatcttttgacaaa
acaaattttaacccttacgaaagctcaatcttatttaaagataaatacattaaaaatgta
tttatacaaagtattatgagctatgtagaaaaaaattctcagaatatagaaacttatgga
tggattgcattctatatttatgctgacaataaggataaaaaaatttattgtcaatacata
aaagaattttttaaaaaaaaaccctttgaaatacaaaatcaaatatttgtatattttcta
tctttttatcccaatattgaaaataaacatttcaagtttatatcagatatactgctttac
cttgacgaaaataaaattacaatacctaaaaaaataataaaaatgcaaaaaataagtccc
aaccaactagattatcaaagatcatatcttttaataaaatcactaaaaacaagatcaaga
attttaaaaattattctcaaaaatataagatttaatcttattgaaaaactagaagatgaa
aatgataaaaaattattacctgcattatactatttaatatattgtgagaatttggtagaa
ttaaaaaacaataaaaagataaaatctaatgaaaaaagtggtttattagaatttatttct
tttttcaaagcaaaattgaagcaaaaaataaattttataaaaagagcttatgaagtctaa

DBGET integrated database retrieval system