KEGG   Bacillus anthracis A0248: BAA_2959Help
Entry
BAA_2959          gene      T00892                                 

Definition
(GenBank) pseudogene
Organism
bai  Bacillus anthracis A0248
SSDB OrthologParalogGene clusterGFIT
Position
complement(2683928..2684059)
Genome map
NT seq 132 nt NT seq  +upstreamnt  +downstreamnt
gtggatttagatcaacaaacggttggtttattattttacgtagttgcagtatcttatatc
attccgtggagaattgcttgctatataaagtttaggaaagtttggcgggggaatagtaat
caaacagtgtaa

DBGET integrated database retrieval system