KEGG   Bartonella australis: BAnh1_t030Help
Entry
BAnh1_t030        tRNA      T02469                                 

Gene name
trnM
Definition
(GenBank) tRNA-Met
  KO
K14230  tRNA Met
Organism
baus  Bartonella australis
Pathway
baus00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:baus00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BAnh1_t030 (trnM)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:baus03100]
    BAnh1_t030 (trnM)
Non-coding RNAs [BR:baus03100]
 Transfer RNA
  tRNA
   BAnh1_t030 (trnM)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(1078956..1079032)
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
gggcctgtagctcaattggttagagccagcggctcataaccgcttggttgggggttcgag
tccctccgggcccacca

DBGET integrated database retrieval system