KEGG   Bifidobacterium animalis subsp. lactis BB-12: BIF_tRNA34Help
Entry
BIF_tRNA34        tRNA      T01840                                 

Definition
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
bbb  Bifidobacterium animalis subsp. lactis BB-12
Pathway
bbb00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bbb00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BIF_tRNA34
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bbb03100]
    BIF_tRNA34
Non-coding RNAs [BR:bbb03100]
 Transfer RNA
  tRNA
   BIF_tRNA34
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
1328764..1328837
Genome map
NT seq 74 nt NT seq  +upstreamnt  +downstreamnt
ggccccgtagctcagctggatagagcatgtgacttctaatctcaaggtcgacggttcgag
cccgtccggggtca

DBGET integrated database retrieval system