KEGG   Blattabacterium sp. (Blattella germanica) Bge: BLBBGE_359Help
Entry
BLBBGE_359        tRNA      T00995                                 

Gene name
trnQ
Definition
(GenBank) tRNA-Gln
  KO
K14223  tRNA Gln
Organism
bbl  Blattabacterium sp. (Blattella germanica) Bge
Pathway
bbl00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bbl00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BLBBGE_359 (trnQ)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bbl03100]
    BLBBGE_359 (trnQ)
Non-coding RNAs [BR:bbl03100]
 Transfer RNA
  tRNA
   BLBBGE_359 (trnQ)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(356963..357038)
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
tagacccgttgtgtaacggtagcacagcagattttggttctgttagttggggttcgagtc
cctacgggtctgttac

DBGET integrated database retrieval system