KEGG   Bifidobacterium breve ACS-071-V-Sch8b: HMPREF9228_0168Help
Entry
HMPREF9228_0168   gene      T01844                                 

Definition
(GenBank) pseudogene
Organism
bbv  Bifidobacterium breve ACS-071-V-Sch8b
SSDB OrthologParalogGene clusterGFIT
Position
complement(209347..210363)
Genome map
NT seq 1017 nt NT seq  +upstreamnt  +downstreamnt
atgagccggcaaaaaccgcggcagcgcggcggccgcgttcctgacaaggccacgccggaa
caggtcatgggcctcgcccgcaacctgccgttgacacacagcgtgcccgggaaggccctg
gaggacgccacgcccggccagctcggcttcctcgccaacctgctggcggccgagaacgcg
agccgggccgaatccaaacggcggcggctgcccaaacaggccgggttcccccagagcaag
accctggacggatacgaccgggggcatggcctcgttccccgccgaccggggccgcgaaca
gccggaaagcctggaattcgtcgaccgggccgaggacctcgtgctctacggcgacgtcgg
ccgcggcaagacccacctggccatcgcgatcggcatgctcgcatgccaacgcatgatacc
cgtgaggttcctcgccgcctccagcctggtcatgcgcttgaggaaggccaaggacgacaa
cagatcggacgccgagctcaagtcgataggcagggccgggccggtcatcatcgacgagcc
cggccacctgcccatcgacatcgacggggccaggctcctgttccaggccggcgcggacag
ctacgagacccgcagcgtcacctccgcctcgaacctcgagtccggcagatagggcgacgt
gtccggagacggggacatggccgccgcggtcatcgaccgcatcgtccaccacggcaggat
cctccgcttccacggcgaatcccatcggaacaaacactccctcatgaaataaaccaaaca
aacaacaaaacaaggaaccaaccgccgacggcgttcaacttgaacgccgacggcgttcag
attaagcgccgaacacgtccacctcaatttgacgaaatacattgcggcgcatggccctgc
ggtacgcgggcccggccacgtggcagcggcccgtccacggacccgtcctgggccgcctgg
gccggcacggccggtacgattcgctctcgctggacgggaaccacgtgtcgcgtctga

DBGET integrated database retrieval system