KEGG   Bifidobacterium breve ACS-071-V-Sch8b: HMPREF9228_0188Help
Entry
HMPREF9228_0188   ncRNA     T01844                                 

Gene name
srpB
Definition
(GenBank) Bacterial signal recognition particle RNA
  KO
K01983  SRP RNA
Organism
bbv  Bifidobacterium breve ACS-071-V-Sch8b
Pathway
bbv03060  Protein export
Brite
KEGG Orthology (KO) [BR:bbv00001]
 09120 Genetic Information Processing
  09123 Folding, sorting and degradation
   03060 Protein export
    HMPREF9228_0188 (srpB)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bbv03100]
    HMPREF9228_0188 (srpB)
Non-coding RNAs [BR:bbv03100]
 Other RNA
  Signal recognition particle
   HMPREF9228_0188 (srpB)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
235423..235520
Genome map
NT seq 98 nt NT seq  +upstreamnt  +downstreamnt
tcacagcctccgcgtggcggtatgtcacccaactcccccagggcaggaatgcagcaaggg
taagtggcctctgccgggtacgtggaggtttttctttt

DBGET integrated database retrieval system