KEGG   Bifidobacterium breve ACS-071-V-Sch8b: HMPREF9228_0209Help
Entry
HMPREF9228_0209   tRNA      T01844                                 

Definition
(GenBank) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
bbv  Bifidobacterium breve ACS-071-V-Sch8b
Pathway
bbv00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bbv00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    HMPREF9228_0209
Non-coding RNAs [BR:bbv03100]
 Transfer RNA
  tRNA
   HMPREF9228_0209
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
261477..261552
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
gcccccatcgtctagcggtctaggactacgccctctcacggcgccaacaccggttcaaat
ccggttgggggtacga

DBGET integrated database retrieval system