KEGG   Bacillus cereus ATCC 14579: BC0240Help
Entry
BC0240            CDS       T00127                                 

Definition
(RefSeq) hypothetical protein
Organism
bce  Bacillus cereus ATCC 14579
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Peptidase_U4 DUF2207
Motif
Other DBs
NCBI-GeneID: 1202593
NCBI-ProteinID: NP_830108
UniProt: Q81IV6
Position
complement(215662..215859)
Genome map
AA seq 65 aa AA seqDB search
MDNLFQYVLHYVLLTIMIVGALLLFPFFPKFVLFLAFFIMLGIAIIISTREDATQKESRV
QRVKL
NT seq 198 nt NT seq  +upstreamnt  +downstreamnt
atggacaacctattccaatacgtcctgcactacgtattattaacaattatgatagtcgga
gcgttattactattcccgttcttcccaaagttcgtcctctttttagctttttttatcatg
ctcgggatcgctattataatttcaacgagagaagatgccacgcaaaaagagagcagggtt
cagcgcgtaaagctgtaa

DBGET integrated database retrieval system