KEGG   Bacillus cereus ATCC 14579: BC0269Help
Entry
BC0269            tRNA      T00127                                 

Definition
(RefSeq) tRNA-Asn
  KO
K14220  tRNA Asn
Organism
bce  Bacillus cereus ATCC 14579
Pathway
bce00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bce00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    BC0269
Non-coding RNAs [BR:bce03100]
 Transfer RNA
  tRNA
   BC0269
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 1202622
Position
243925..243999
Genome map
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
tccgcagtagctcagtggtagagctatcggctgttaaccgatcggtcgtaggttcgagtc
ctacctgcggagcca

DBGET integrated database retrieval system